Jiawei Liangxue Xiaofeng powder regulation of psoriasis vulgaris (blood heat syndrome) expression of peripheral white blood cell Notch channel before and after treatment
Hao Pingsheng Zhou Qian Zhang Jing
Department of Dermatology, Affiliated Hospital of Chengdu University of Traditional Chinese Medicine 610072
[Abstract]Objective: To observe the expression of Notch1 receptor and downstream target gene Hes-1 in peripheral neutrophil Notch signal pathway from patients with psoriasis vulgaris (blood heat syndrome), and the regulation of Jiawei Liangxue Xiaofeng powder for the expression of Notch1 receptor and downstream target gene Hes-1 before and after treatment. Method: Isolating the peripheral WBC of 30 patients with psoriasis vulgaris (blood heat syndrome) before and after treatment, taking β-actin as an internal reference gene, using real time fluorescent quantitative PCR to detect the expression of Notch1 receptor and downstream target gene Hes-1 and comparing the result with healthy individuals before and after treatment. Result: Between healthy individuals and psoriasis vulgaris (blood heat syndrome) patients, the expression of Notch1 is statistically significant (P=0.014<P=0.05); also, the expression of Hes-1 are statistically different (P=0.033<P=0.05). From these indexes,we can reach the conclusion that there is high expression of Notch1 receptor and downstream target gene Hes-1 in peripheral neutrophil Notch signal pathway in patients with psoriasis vulgaris (blood heat syndrome). By Paired-Sample T Test, there is statistical difference of Notch1 before and after treatment (P=0.000<P=0.001); by Nonparametric Wilcoxon Rank-Sum test, there is statistically significant of Hes-1 amplification before and after treatment (P=0.048<P=0.05). They show that Jiawei Liangxue Xiaofeng powder can down-regulate the expression of Notch1 gene and Hes-1 gene. Conclusion: We can speculate that Jiawei Liangxue Xiaofeng powder play an anti-inflammatory role through reducing the activation of peripheral neutrophil in patients with psoriasis vulgaris. But whether the neutrophil influences the keratosis of keratinocytes by regulating Notch signal pathway between cells or Jiawei Liangxue Xiaofeng powder blocks the transmission of differentiation information need our further study.
[Keywords]: Jiawei Liangxue Xiaofeng powder; psoriasis vulgaris; blood heat syndrome; Notch1 receptor; gene Hes-1
Psoriasis Vulgaris(PV) is a commonly chronic inflammatory dermal disease. It is characterized by hyperplasia of keratinocytes, inflammatory cell infiltration and neovascularization. Due to long duration and easy recurrence, psoriasis vulgaris results in severe influence on patients’ health and life quality. What is more, there is still no specific medicine to treat psoriasis vulgaris, so, it has been one of the dermal diseases for emphatic study.
With the holistic viewpoints and treatment offered upon syndrome differentiation, Chinese medicine achieved a good therapeutic effect for psoriasis vulgaris at present. However, since lack of objective laboratory index to observe TCM syndrome, we can’t have a deep research on the mechanism of action and drug targets of Chinese medicine.
In this experiment, we detect the expression of Notch pathway in peripheral blood in patients with psoriasis vulgaris (blood heat syndrome) before and after treatment, and expect to know part of the mechanism that how Ai’s empirical formula-- Jiawei Liangxue Xiaofeng powder cure psoriasis vulgaris (blood heat syndrome) patients, as a result, provide experimental support for the treatment of this disease by Chinese medicine.
1. Materials and Methods
1.1 General datas
30 outpatients with psoriasis vulgaris (blood heat syndrome) are collected from department of dermatology, affiliated hospital of Chengdu university of TCM in November 2013 to February 2014. There are 13 males and 17 females with an average age of (32.6±10.30) years and an average duration of (46.13±18.46)months. There are 10 people in healthy group (4 males, 6 females). They are all adults with an average age of (30.6±9.2) years. By Paired-Sample T Test, there are statistical difference between the two groups(P>0.05).
1.2 Western Medicine diagnostic criteria and syndrome differentiation standard of TCM
Western medicine diagnostic criteria of psoriasis vulgaris comes from the textbook –Dermatovenereology, which the chief compiler of it is Zhang Xuejun[1]
Syndrome differentiation standard of TCM for psoriasis vulgaris (blood heat syndrome) comes from the book--A newly compiled dermatology of TCM, which the chief compiler of it is Ou Yangheng, and Clinical guideline of new drugs for traditional Chinese medicine enacted by State Drug Administration in 2002[2-3]
1.3 Inclusive criteria ①The symptoms of patients should conform to the diagnostic criteria of psoriasis vulgaris in active stage; ②The manifestation should accord with blood heat syndrome standard in TCM; ③Within 18~70 years old, all genders; ④The patients had no other severe primary disease, such as cardiovascular and cerebrovascular disease, liver and kidney disease, hematopoietic system disorder, chronic consumptive disease and psychosis ; ⑤The patients had not taken retinoid, glucocorticoid and methotrexate to treat during the past month.
1.4Exclusive criteria ①Under 18 years old or over 70; ②Patients with other dermal disease; ③Patients with mental disorder; ④Patients with severe systemic chronic consumptive disease; ⑤Patients with other types of psoriasis vulgaris; ⑥Patients who received retinoid, glucocorticoid and methotrexate to treat during the past month.
1.5 Therapeutic method
1.5.1 The preparation of Jiawei Liangxue Xiaofeng powder
Formula: Shuiniujiao(Cornu Bubali)30g, raw Dihuang(Radix Rehmanniae)20g, Mudanpi(Cortex Moutan Radicis)15g, Jiangcan(Bombyx Batryticatus)10g, Decoct Digupi(Cortex Lycii Radicis)15g, Zijingpi(Cercis chinensis Bunge)15g, Dongsangye(Folium Mori)5g, baked Gancao(Radix Glycyrrhizae)3g, Baihuasheshecao(Herba Hedyotis Diffusae)30g, Xuanshen(Radix Scrophulariae)15g, Nvzhenzi(Fructus Ligustri Lycii)15g, Mohanlian(Herba Ecliptae)20g.
Boiling method: Firstly, we pour 600ml water into the container, then, boil the water until it remained 300ml and be sure there is 66.6g medicine in 100ml fluid, at last, dump the remained fluid into 3 plastic bags averagely. These procedures will be done by pharmacy department in our hospital.
1.5.2 Taking method and cycle
Take the warm medicine 100ml three times a day by mouth in half an hour after a meal and the patient should take it 4 weekends continuously.
1.6 The detecting of Notch1 and Hes-1 in peripheral WBC
1.6.1 Key reagents : Red Cell Lysis Buffer: Made in TIANGEN, Cat:RT 122-02,Lot:M2114; TRNAzol:TRIZOL, batch number:15596-026, standard: 100ml/bottle, made by Invitrogen in America; RNA Loading Buffer, batch number:A501A, standard: 1ml/tube, made by TAKARA; PrimeScript RT reagent Kit,batch number:BK501,standard:100 Preps,made by TAKARA; RNAiso Plus Kit,batch number:BK3303,standard:100 Preps, made by TAKARA; ;RNA Marker RL 6,000,batch number:AK101,standard: 20 Preps, made by TAKARA.
1.6.2Key instruments: Real-time fluorescent quantitative PCR(RT-PCR), model: PIKORed 96, made by ThermoFisher in America; electrophoresis apparatus, model: JY200C,made by Junyi electrophoresis; electrophoresis tank, model: JY-SPFT,made by Junyi electrophoresis; Chemiluminescence gel-imaging analysis system, model: JY-Clear ECL,made by Junyi electrophoresis.
1.6.3 Experimental procedures
1.6.3.1 Extraction of WBC: Isolate neutrophils as the lysis of RBC[4], then put 2ml EDTA anticoagulant in I:3(V/V) red cell lysis buffer under aseptic conditions, after that, shake it well and let it sit for 15 minutes at room temperature, and then, centrifuge the fluid for 5 minutes at 1000r/min. Sop up the supernatant, then pyrolysis RBC again, remain the WBC in the bottom of the tube, and then, mix with 2ml PBS which contains 1% BSA, next, shake it well and pour it into the surface of the centrifuge tube which had 4ml 60% percoll and centrifuge the fluid for 20 minutes at 2000r/min. Lastly, remain the neutrophils in the bottom of the tube and clean it with PBS which contain 1%BSA two times, then cryopreserve it at -80℃.
1.6.3.2 Extraction of total RNA in tissue Thaw the WBC at room temperature and add 1ml TRIZOL, let it stand, then pour 1ml trizol which have 0.2ml chloroform into it again, after that, cap it and shake violently for 15s, let it sit for 2-3 minutes at room temperature; centrifuge the fluid for 15 minutes(1000rpm/min,2-8℃)and discard the supernatant; after that, add the same amount of isopropanol and let it stand at room temperature; next, centrifuge the fluid for 10 minutes(1000rpm/min,2-8℃) and discard the supernatant too; clean RNA: precipitate and stand 1ml 75% alcohol; centrifuge it for 5 minutes(5000rpm/min,2-8℃) and discard the supernatant; dissolve DEPC by water and put it in the EP tube.
1.6.3.3 Determination of RNA: Mix 0.4g agarose with 40ml 0.5×TBE solution until the solution clear and transparent; when it cooling, add 2μl nucleic acid dye in the solution ; then adjust it to the level of gel; after the gel cooling and solidification, we spot it in electrophoresis tank which has electrophoresis buffer; after that, we can electrophoresis when we regulate the parameter at U:100V;A;200A;T:30 min respectively.
1.6.3.4 The cDNA produced by reverse transcription of RNA
1.6.3.4.1 The reaction of removing DNA in gene group: We add 5×gDNA Eraser Buffer 2ul, gDNA Eraser 1ul, Total RNA 1ul and RNase Free dH2O 6ul in turn and let it sit 2min at 42℃ .
1.6.3.4.2 The reaction of reverse transcription: We preparation reaction system as the way on the test kit: that is: adding 5×PrimeScript Buffer 2 4ul,PrimeScript RT Enzyme Mix I 1ul,RT Primer Mix 1ul,RNA10ul and RNase Free dH2O 4ul one by one and putting it on the PCR machine to reaction.
1.6.3.5 Real-time fluorescent quantitative PCR
1.6.3.5.1 The design and synthesis of primer: Search and download the total gene sequence of human β-actin(NM_007393.3)from NCBI database and use Primer Premier 5 to design and screen each specific primer of gene. All primers are designed and synthesized by Sangon Biotech and purify with ULTRAPAGE. Table 1 is to show all the primers and base sequence used in this test:
Table 1 the primers and base sequence used in this test
The name of primer |
upstream |
downstream |
β-action |
gaagatcaagatcattgctcct |
tactcctgcttgctgatcca |
Notch1 |
tcggagtgtgtatgccaagagt |
agggaccaagaacttgtataaccaa |
Hes-1 |
cggctaaggtgtttggag |
gctgttgctggtgtagac |
1.6.3.5.2 The reaction of real-time PCR
The reaction system of PCR: At first, SYBR Primix Ex TaqⅡ(2×) 10.0 ul;PCR Forward Primer(0.4μM) 0.8 ul;PCR Reverse Primer(0.4μM) 0.8 ul;cDNA 2.0ul;ddH2O 6.4 ul be prepared. Then, place the prepared test sample on the device. The reaction procedure of PCR: 95℃30sec;40 cycles 95℃ 5sec,55℃ 30sec, 72℃ 30sec, be sure full extension to collect fluorescence.
After that, apply Sequence Detection software version 1.2.3 (Applied Biopsy stems company ) to analyze the Threshold cycle of the test sample during the PCR procedure. We compute the expression level of X relativing to mRNA through 2- △△CT.
1.7 Statistical treatment
SPSS 13.0 software is applied for statistics and we detect the difference of Notch1 and Hes-1 between patients with psoriasis vulgaris (blood heat syndrome) and healthy people by T-test; Paired-Sample T Test was used for Notch1 amplification before and treatment and we use nonparametric Wilcoxon Rank-Sum test to detect Hes-1 amplification before and after treatment. If P<0.05, there was statistical difference.
2. Results
2.1 The following charts show the amplification curve ofβ-actin、Notch1 and Hes-1:
Charts 1 the amplification curve ofβ-actin Charts 2 the amplification curve of Notch1
Charts 3 the amplification curve of Hes-1
2.2 The amplification expression of Notch1 and Hes-1 in patients with psoriasis vulgaris (blood heat syndrome)
Table 2 The gene expression of Hes-1 and Notch1 in neutrophils of patients with psoriasis vulgaris (blood heat syndrome) and healthy people (±s)
groups |
cases |
Hes-1 Notch1 |
Healthy person
Control group
T
Z
p |
10
20
|
0.537±0.350 0.660±0.137
3.523±9.925 0.837±0.289
2.29
-2.465
0.033 0.014 |
Note: Between healthy individuals and patients with psoriasis vulgaris (blood heat syndrome), the expression of Notch1 is statistically different (P=0.014<P=0.05); also, the expression of Hes-1 is statistically different (P=0.033<P=0.05).
2.3 The contrast of Notch1 amplification and Hes-1 amplification before and after treatment
Table 3 The contrast of Hes-1 amplification and Notch1 amplification in neutrophils before and after treatment of patients with psoriasis vulgaris (blood heat syndrome) (±s)
Groups |
cases |
Before treatment after treatment T Z P |
Notch1 amplication
Hes-1 amplication |
30
30
|
0.837±0.289 0.555±0.204 4.991 0.000
3.523±9.925 1.616±4.973 -1.981 0.048 |
Note: By Paired-Sample T Test, the correlation coefficient r = 0.022 > 0, so we can say it is a valid paired design. The paired sample test show that t=4.991, df=20, from marginal table of t, we can see t0.001/2,(20)=3.85, because |t|>t0.01, there is statistical difference p=0.000(p<0.05). Because the value of Hes-1 does not comply with normal distribution in two times, we should use Nonparametric Wilcoxon Rank-Sum test. From the above table we know the bilateral approximate probability p=0.048(p<0.05) and there is statistically significant.
3. Discussion
Psoriasis vulgaris was known as “baibi”、“dry tinea”、“bark of pine tinea”and so on in ancient times. It is a chronic recurrent inflammatory dermal disease. The main pathologic changes are hyperplasia of keratinocytes, inflammatory cell infiltration and neovascularization. Most of the inflammatory cells are neutrophils and only a little is lymphocytes. At the early stage, it is widely believed that the inflammatory infiltration in psoriatic skin lesion followed an epidermal hyperplasia, but the later study found that there are many activated CD4+ cells (helper T cell) permeate epidermis of active stage plaque. However, there are many CD8+ cells (suppressor T cell) permeate epidermis of subside period plaque. From the angle of immune-mediation, the research to inflammatory cells focus on T lymphocyte, and we named the procedure that T cells escape from peripheral vessel and remove to skin dermal WBC migration. But from the perspective of pathology, there are Munro’s small abscesses formed by neutrophils in parakeratosis region with psoriasis vulgaris, and there are many neutrophils infiltration around dermal blood cell also. However, the research on the neutrophils is rare.
Notch signal pathway distributes widely in living body and the main function of it is mediating the differentiation of suppressor cells. It participates in the procedure of cells differentiation, motility, proliferation, growth and apoptosis through the interaction of adjacent cells, so it plays a fundamental and important role in the growth and development process of metazoan. The continuous effect of signal path causes cells failing to differentiate normally but hyperproliferation, as a result, various proliferative diseases occurred[5]
Notch signal pathway is composed of massive molecules and proteins, the main parts are Notch ligands, Notch receptors and intracellular effect molecules. The activation and regulation of Notch signal pathway can occur in extracellular, intracellular and nuclear. The binding of receptor and ligand results in the activation of Notch signal path, then all or most of the extracellular sequence be removed by enzyme and the remained intracellular domain enters into nuclear to interact with transcription factor, consequently, achieves the regulation for target gene[6]. Notch1 gene is a prominent receptor in Notch signal pathway and some data confirm that the high expression of Notch1 receptor may participate in the immune dysfunction of psoriasis caused by lymphocyte[7]. Hes-1 is one of the key downstream target genes in Notch signal pathway and also, transcription inhibitor. It can inhibit the development and differentiation of variety cells in vitro and vivo[8]. Generally speaking, detecting Hes-1gene can indirectly reflect the strong or weak expression of Notch signal pathway. Some data[9] show that the overexpression of genes involved in the Notch signaling pathway may participate in the activation of peripheral blood T cells, which appears to be closely associated with the pathogenesis of psoriasis. However, the study on neutrophils is rare.
Jiawei Liangxue Xiaofeng powder is Ai Rudi’s (a distinguished TCM doctor in our hospital) empirical formula for curing psoriasis vulgaris (blood heat syndrome). Our clinical experience [10]confirms that Jiawei Liangxue Xiaofeng powder has a definite effect, also, the experiment[11] shows that Jiawei Liangxue Xiaofeng powder can cure psoriasis by inhibiting the keratosis of keratinocyte, anti-inflammatory, inhibiting the expression of PCNA and regulating of TNF-α。
From the experimental results, we can see that the expression of Hes-1 and Notch1 in peripheral neutrophils of patients with psoriasis vulgaris (blood heat syndrome) is higher than healthy person. This conclusion reveals some significance of “invasion of heat into nutrient blood”in TCM from the angle of gene. Because neutrophils participate in the pathogenesis of psoriasis vulgaris and forms Munro’s small abscess in parakeratosis region, also, Notch path can precisely regulate and control the differentiation of each lineage cells through the interaction of adjacent cells, however, whether these neutrophils regulate and affect the keratosis of keratinocyte through Notch signal pathway need our further study.
The data tells us that Jiawei Liangxue Xiaofeng powder can down-regulate the expression of Notch1 receptor and Hes-1 gene of Notch signal pathway in peripheral WBC. We speculate that maybe Jiawei Liangxue Xiaofeng powder plays an anti-inflammatory role through decreasing the activation of peripheral neutrophils in psoriasis patients.
References:
[1]Zhang Xuejun, He Chunshui and Lu Hongguang et alii, Dermatovenereology, Beijing: People's Medical Publishing House, 2008, 7th edition: 141~144.
[2]Zheng Xiaoyu, Clinical guideline of new drugs for traditional Chinese medicine [M] Beijing: Medicine Science and Technology Press of China,2002:299~302
[3]Ou Yangheng and Yang Zhibo, A newly compiled dermatology of TCM, Beijing: People's Medical Publishing House, 2000:332~338
[4]Fredriksson T, Pettersson U. Severe Psorciasis oral therapy with a new retinoid.Dermatological.1978.157:238~240
[5]Spyros Artavanis-Tsakonas,Matthew D. Rand,Robert J. Lake. Notch Signaling: Cell F5ate Control and Signal Integration in Development. Scinence [J].1999,4(30):770-776
[6]Judith Kimble. The LIN-12/Notch signaling pathway and its regulation. CELL DEVELOPMENTAL BIOLOGY, 1997.13:333-61
[7]Hou Ruixia, Li Junqin and Liu Ruifeng et alii, Expressions of Notch receptors and target genes in bone marrow CD34+ cells from patients with psoriasis, Chinese Journal of Dermatology,2011.44.(3):168-170
[8]Castella P,Sawai S,Nakao K.et a1.HES-1.repression of differentiation and proliferation in PCI2 cells:role for the helix 3-helix 4 domain in transeription repression.Mol Cell Biol,2000,20(16):6170-6183.
[9]Li Xinhua, An Peng and Li Junqin et alii, Expression of genes involved in the Notch signaling pathway in peripheral blood T cells from patients with psoriasis, Chinese Journal of Dermatology,2013.46.(3):189-190
[10]Hao Pingsheng, Jiawei Liangxue Xiaofeng powder cure 30 patients with active stage psoriasis vulgaris (blood heat syndrome), Pharmacy and Clinics of Chinese Materia Medica, 2011.7(3):50-52
[11] Hao Pingsheng, The expression of TNF-αin the tissue of guinea pigs model with psoriasis and the regulation of Jiawei Liangxue Xiaofeng powder, Journal of Chengdu University of TCM, 2011,34(3):29-32
Source of foundation: The project of preventing and curing serious disease and talents training fund of Sichuan province(2012-E-046)